32 Zero to Genetic Engineering Hero - Chapter 1 - Isolating DNA, the Blueprints of Life
Understanding the nomenclature
of DNA
In the hands-on exercise of this chapter, you isolated
genomic DNA. There are a lot of words that are used
to describe DNA. There is DNA, double helix, genes,
genomes, chromosomes, genomic DNA and more. All
of these can be used to describe DNA at different
scales or forms. Let’s break this down by looking at
DNA from its building blocks up to the “megastruc-
tures” that are made from it.
Atoms are the building blocks of molecules, inculuing
nucleotides. Earlier you learned that the building
blocks of nucleotides are CHOPN. Do you remember
what CHOPN stands for? See the periodic table at the
end of the book to refresh your memory.
Nucleotides are the building blocks of a DNA strand:
The nucleotides adenosine, thymidine, guanosine, and
cytidine are the building blocks of a string of DNA. More
commonly they are referred to by their nitrogenous
base names: adenine, thymine, guanine, and cytosine.
DNA strand: is when several nucleotides become
bound together via the sugar-phosphate backbone.
Two DNA strands form a double helix: When two
complementary strands of DNA join (using Chargaff’s
Rule), they form double-stranded DNA, and the
three-dimensional structure is called a double helix.
A Gene is a segment of double-stranded DNA helix
that has all the information required to be read by a
cell; which then ‘expresses the gene’, producing a
cellular product or outcome. This expression of a
gene can result in a physical change in the organism.
A gene can be a 100 to 14,000 nucleotides long. There
A plasmid is a short circular DNA helix: A double helix
that is generally between 1,000 and 100,000 nucleo-
tides long and is circular, is called plasmid (Figure
1-20). Just like a pearl necklace is made of pearl “build-
ing blocks” and is circular, the DNA helix can form tiny
discussion throughout this book. They are frequently
used in genetic engineering, and cells often share
plasmids that help them survive and evolve. In
computer terms, a plasmid is similar to a USB stick for
cells. It is transferable mobile data storage.
A chromosome is a long circular or straight DNA
helix that carries the primary information that the
cell uses to survive. Throughout this book, we will be
engineering Escherichia coli (E. coli) bacteria. E. coli
bacteria have a circular chromosome that is about
4,600,000 nucleotides long. Compare this to a human
cell that has 46 straight chromosomes of varying
lengths (generally between 10,000,000 and
100,000,000 nucleotides long).
A genome refers not necessarily to a single physical
structure in a cell (like a chromosome), but to all of
the organism’s DNA. Each living cell contains a copy
of that organism’s genome. In the case of a single-
celled bacteria like E. coli, its genome is made up of a
single large chromosome of 4,600,000 nucleotides
and in some cases some small plasmids. In contrast,
your human genome includes the 46 (or so) chromo-
somes that total about 6,000,000,000 nucleotides as
well as your mitochondrial DNA (mitochondria is the
energy factory within your cells that has its own DNA).
When you extracted genomic DNA from the straw-
berry, this means you attempted to extract all of the
cell’s DNA.
Figure 1-20. A plasmid is a short circular DNA helix
Book _genetic engineering hero-AUG2021.indb 32Book _genetic engineering hero-AUG2021.indb 32 8/18/21 12:03 PM8/18/21 12:03 PM
33Zero to Genetic Engineering Hero - Chapter 1 - Isolating DNA, the Blueprints of Life
Negative charge of DNA Going Deeper 1-5
Recall during the precipitation exercise that the DNA had a charge. The charge of the DNA makes it
“water-loving” because water also has charge. This keeps the DNA dissolved in the water. Have a closer look
at the negatively charged sugar-phosphate backbone (Figure 1-17) and the DNA double helix (Figure 1-19).
oxygen atoms of the phosphate group. It is this phosphate group which enabled you to use hydrophilic /
hydrophobic chemistry to precipitate the DNA. When you’re doing chemistry in general, whether it is
biochemistry (the chemistry of biology) or not, you must understand the chemical nature of your molecules
to know how to manipulate them. Chapter 6 Fundamentals goes in-depth into bonding.
Could your DNA stretch to the moon and back? Going Deeper 1-6
If you look back to Figure 1-17, you’ll see some DNA strands. What is the distance from the beginning of a
0.00000000033 meters. Consider humans have about 6 billion nucleotides of DNA in both strands of DNA
in each cell. Therefore the DNA in each of your cells is 3 billion nucleotides long. Each of your cells has:
3,000,000,000 (nucleotides long per cell) x 0.00000000033 m = 0.99 m of DNA per cell!
Find out how long a meter is and imagine that each one of your cells, that you need a microscope to see, has
1 meter of DNA neatly wrapped up and packaged inside! If you’re wondering how it could be possible to do
this, imagine a spool of thread. You can easily hold a spool of thread in the palm of your hand, however, if
you are allowed, unroll the entire spool and see how long the string is! Maybe the string will be an entire
city block long!
Now for the second part of the calculation. It is estimated that the average human has more than one trillion
cells that carry your DNA genome. It is important to note that you probably have around 30 trillion red blood
cells, but because red blood cells lose their DNA when they become red blood cells, we cannot consider
them in this calculation. For simple calculation, let’s say you have one trillion cells with DNA.
0.99 m (DNA length per cell) x 1,000,000,000,000 (cells) = 990,000,000,000 meters!
With this conservative calculation, that is 990,000,000 km of DNA in your body.
The distance between the earth and sun is 149,600,000 km:
990,000,000 km (DNA in your body) / 149,600,000 km (between earth and sun) = 6.6 times
Your DNA would stretch between the earth and our sun almost seven times!
The distance to our nearest star neighbor, Alpha Centauri A, is 4.22 light-years away. This is equal to about
13,000 astronomical units (AU). An astronomical unit is the distance between the earth and our sun. How
many people’s DNA would need to be strung together to reach the nearest star?
13,000 AU / 6.6 = 1,967 people
If you were able to gather up almost 2,000 people, all of their DNA, if stretch out and connected in one long
thread, would reach all the way to our nearest celestial star neighbor, Alpha Centauri A!!!
Book _genetic engineering hero-AUG2021.indb 33Book _genetic engineering hero-AUG2021.indb 33 8/18/21 12:03 PM8/18/21 12:03 PM
34 Zero to Genetic Engineering Hero - Chapter 1 - Isolating DNA, the Blueprints of Life
DNA extractions in the real-world
Although tremendous advances have been made in
DNA science over the past decades, we are still learn-
ing the basics of how biology works. We do not yet
have the capability of designing a DNA sequence from
scratch to perform a particular function or result in a
-
sary for genetic engineers, scientists, and enthusiasts
to go ‘prospecting’ in nature for snippets of DNA that
make interesting and useful cellular products or
cellular machinery.
Just like you extracted the DNA from a strawberry,
genetic engineers collect samples of organisms in
nature and extract their genomic DNA. They then
send the extracted DNA to companies that have a
technology called DNA sequencers that can read the
DNA to determine the DNA sequence. With the new
interesting and useful functions which can then be
used in genetic engineering projects.
Sometimes this prospecting leads to the discovery of a
DNA sequence that results in a multi-billion dollar
for discovering the Green Fluorescent Protein (GFP).
-
neering project. The stories told by the laureates can
be found on nobelprize.org, notably, “Nobel Lecture by
Osamu Shimomura (29 minutes)”
It all started with curiosity - what made some species
Shimomura spent decades working toward under-
standing this question. In the early part of the
research, Dr. Shimomura and his colleagues had to
fellow scientists, and even their family members
through much trial and error, they were able to purify
enough of the Green Fluorescent Protein (GFP) from
their samples to determine how it worked.
GFP DNA into a bacteria, and have the bacteria
it also led to the creation of new and better versions
of GFP by changing the original DNA sequence. There
Figure 1-21. Marine divers exploring the oceans for new organisms.
Book _genetic engineering hero-AUG2021.indb 34Book _genetic engineering hero-AUG2021.indb 34 8/18/21 12:03 PM8/18/21 12:03 PM
35Zero to Genetic Engineering Hero - Chapter 1 - Isolating DNA, the Blueprints of Life
are now versions of GFP that are brighter, last longer,
proteins are now so widely used that thousands of
laboratories worldwide depend on them as a research
tool to discover how cells work so that medicines may
be created. In other words, the discovery of the DNA
sequence used to make GFP led to the creation of a
multi-billion dollar industry and many new medi-
cines that save lives every day.
In later chapters, you will be able to do this Nobel
Prospecting for high-value biological products
continues today. Medicines from plants and animals,
oils from plants are all examples of products that
have been or are being prospected. Prospecting for
useful “cellular machinery” is a lucrative business.
For example, the biotechnology company New England
Biolabs (commonly called “NEB”), offers more than
1000 different “molecular scissors” called restriction
and isolated from naturally-occurring bacteria. Did
you hear about CRISPR in the news? CRISPR/Cas-9
was also prospected from bacteria in the environ-
ment and has since become a game changer in
biotechnology and medicine! The sales from pros-
pected biological products currently amount to
billions of dollars in revenue each year.
What can modern-day prospecting look like? Starting
in 2003, with his private yacht, genomics pioneer Dr.
Craig Venter, began sailing the ocean, looking for
industrially useful life forms. In 2004 he and
Exxon-Mobil launched the Global Ocean Sampling
the ocean to “assess genetic diversity in marine
microbial communities and to understand their role
in nature’s fundamental processes”. In a more recent
2010 expedition, funding support was provided by
one of the largest biotechnology companies. We will
probably see the fruits of their expeditions in the
coming years as critical life-saving technologies that
earn their prospectors a handsome salary.
Figure 1-22.
Is DNA the ultimate code? Going Deeper 1-7
You may be familiar with or have seen the binary information that computers use to compute. At the most
basic level, computers use switches called transistors which are either on or off - which the computer
designates a “1” or a “0”. Binary is the language that computers know how to read and write, but it’s quite
hard for a human to understand!
01100111 01100111 01100011 01100111 01100001 01100001 01100001 01100001 01100011 01100111 01100001 01100001
01100001 01100011 01100011 01100001 01110100 01110100 01110100 01100111 01100011 01100111 01100001 01100001
01100001 01100001 01100011 01100111 01100111 01100011 01100001 01110100 01110100 01100001 01100001 01100011
01100111 01100001 01100001 01100111 01100001 01100001 01100011 01100111 01100011 01100001 01110100 01100011
01100111 01100111 01100011 01100001 01110100 01110100 01100001 01100111 01100011 01100111 01100111 01100011
01100011 01100111 01100011 01100111 01100001 01100001 01100111 01100011 01100111 01100001 01100011 01100011
In the case of cells, the information is stored in DNA. Rather than 0s and 1s, it is a string of As, Ts, Gs, and
Cs. The order of nucleotides in DNA stores the language that cells know how to read and write.
GGCGAAAACGAAACCATTTGCGAAAACGGCATTAACGAAGAACGCATCGGCATTAGCGGCCGCGAAGCGACC
Book _genetic engineering hero-AUG2021.indb 35Book _genetic engineering hero-AUG2021.indb 35 8/18/21 12:03 PM8/18/21 12:03 PM
36 Zero to Genetic Engineering Hero - Chapter 1 - Isolating DNA, the Blueprints of Life
Summary and What’s Next?
fruit cells in a salt slurry, lysed them open with a
surfactant to release the DNA into the environment,
which you filtered and precipitated. Were you
surprised at the amount of DNA in a strawberry?
The hands-on skills and underlying chemical princi-
ples you learned during the exercise are essential and
broadly used in genetic engineering. In fact, you will
be using them in later chapters, so try not to forget
them!
In this chapter, we also began to look at the structure
of DNA to better understand why you were able to
purify and precipitate the DNA using the chemistry
you employed. We then discussed how DNA is like the
blueprint of cells, holding information about how
cells make important cellular molecules, and how to
grow and divide. When we looked at DNA up close, we
saw that there were four nucleotides named after
their nitrogenous bases (adenine (A), thymine (T),
guanine (G), and cytosine (C)) that are all made of
CHOPN atoms. The nucleotides are strung together
into strands by cell machinery. It is the order of the
nucleotides (the sequence) that holds the information
that cell machinery understands how to read and
write. You too will know how to read DNA by the end
of Chapter 4!
We learned about how DNA can be changed and modi-
and that we’re going to use these precise methods to
change the cell‘s genome in later chapters. More
broadly, we learned about how DNA changes naturally
in the environment and how those changes are at the
core of evolution.
In Chapter 2 we are going to look at what it takes to set
up a safe genetic engineering area at home, school,
and the makerspace, with a Minilab and explore
biosafety considerations so that you will be ready to
become a Genetic Engineering Hero!
Is DNA the chicken or the egg? Breakout Discussion
the egg? Now you can take that contemplation one level
deeper!
If DNA is the blueprint for a cell, and cell machinery is
required to read DNA, create DNA, and also to produce
If there was no cell, how was DNA created and read? If
there was no DNA, where did a cell and the cell machinery
come from?
inheritance, this question has persisted. Present-day
Another molecule that will be covered in Chapter 4, called
ribonucleic acid (RNA), is presently thought to have been
for cell machinery but is also able to cause chemical reac-
tions to happen, like those performed by cell machinery.
But this is just a theory. We still do not know the answer...yet!
Book _genetic engineering hero-AUG2021.indb 36Book _genetic engineering hero-AUG2021.indb 36 8/18/21 12:03 PM8/18/21 12:03 PM
..................Content has been hidden....................
You can't read the all page of ebook, please click here login for view all page.