46.2.1 Objective

To search for predicted miRNA sequences in the human genome for the gene “HMGA2”.

46.2.2 Procedure

1. Open the TargetScan web server: http://targetscan.org/
2. Select the species “Human” and enter the human gene symbol (i.e., HMGA2).
3. Select the required conditions from the drop‐down menu of given options.
4. Click on the “submit” button to obtain the result, or the “reset” button to perform a new prediction (Figure 46.1).

46.2.3 Results

1. For the gene “HMGA2”, TargetScan gives multiple transcripts. Click on the transcript to see the details.
2. The resulting page gives the conserved sites for miRNA families corresponding to the gene HMGA2 (in all the Mammalia in this case).
3. The table has compiled detailed information (position, length, score, etc.) about the conserved sites for miRNA families corresponding to the gene HMGA2).

46.3.1 Objective

To search for all the predicted miRNA targets for the miRNA “miR‐1‐3p” in the TargetScan tool.

46.3.2 Procedure

1. Select the species “Human” and enter the microRNA name (i.e., miR‐1‐3p).
2. Click on the “submit” button to obtain the result or the “reset” button to perform a new prediction.

46.3.3 Results

The resulting page gives a list of all the predicted targets for the human miRNA “miR‐1‐3p”. The table has the information about the target gene symbol, transcripts with sites, gene name, score, and so on.

46.4.1 Objective

To search for the targets of Arabidopsis thaliana (denoted as ath) miRNA sequences as inputted by the user, against a genomic library of Arabidopsis thaliana.

46.4.2 Procedure

1. Open psRNATarget web server: http://plantgrn.noble.org/psRNATarget/.
2. Paste the following Arabidopsis thaliana miRNA sequences in the box provided:
   • >ath‐miR156a UGACAGAAGAGAGUGAGCAC
   • >ath‐miR157a UUGACAGAAGAUAGAGAGCAC
   • >ath‐miR158a UCCCAAAUGUAGACAAAGCA
   • >ath‐miR398a UGUGUUCUCAGGUCACCCCUU
   • >ath‐miR398b UGUGUUCUCAGGUCACCCCUG
   • >ath‐miR398c UGUGUUCUCAGGUCACCCCUG
   • >ath‐miR834 UGGUAGCAGUAGCGGUGGUAA
   • >ath‐miR390a AAGCUCAGGAGGGAUAGCGCC
   • >ath‐miR390b AAGCUCAGGAGGGAUAGCGCC
3. An existing library of transcripts or a genomic library for target search is to be selected from the list – namely, Arabidopsis thaliana, genomic DNA, 3.4 K segments from a strand with 0.4 K overlapped region, TAIR.
4. Add the required parameters given options, or use default values.
5. Click on the “submit” button to obtain the result or the “reset” button to perform a new prediction.

46.4.3 Results

The result page gives a list of predicted miRNA/Target pairs for the input miRNA sequences against the selected genomic library. The result tabulates miRNA accession, target accession, expectation score, target accessibility, alignment, and also the target description. The server also has a facility for batch‐downloading of the complete result.

46.5.1 Objective

To search for the targets of user submitted miRNA sequences against the RNA sequence.

46.5.2 Procedure

Here, sheep miRNA will be used to predict the target by search against the set of sheep RNA, using miRanda:

1. Paste the following sequence, create an input file named mature.fa. and keep it in the src directory of miRandatool:
   • >oar‐let‐7b MIMAT0014963 UGAGGUAGUAGGUUGUGUGGU
2. Download a coding set of sheep from NCBI from the link ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF_000298735.2_Oar_v4.0/GCF_000298735.2_Oar_v4.0_rna.fna.gz, and keep in the src directory of miRanda software.
3. Sheep.fa is the coding sequence for sheep, as downloaded from NCBI.
4. Type the command./mirandamature.fasheep.fa > sheep_target.out

46.5.3 Result

miRanda provides details on predicted miRNA/Target pairs for the input miRNA sequences against the coding sequence of sheep. Gene symbol, gene names, RefSeq id, alignment, score, and so on are stored in the output file.